IGR sequence: | igr2953#chr2#x1=14363467#l=4130 |
---|---|
Mature miRNA sequence: | AAUAUUCUCUCCGUUUCACAAU |
encoded miRNA: | MIR73a |
Precursor location: | 321 - 544 (positive strand) |
precursor length: | 224 (61 basepairs) |
MIR position: | 1 - 22 (321 - 342) |
MIR length: | 22 (17 paired bases) |
miRNA location TIGR v3: | chr2:14363787>14364010 |
miRNA location TIGR v5: | chr2:14422400>14422623 |
Folding energy: | -43.87 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** AAUAUUCUCU CCGUUUCACA AUAUAAGUUG UUUUAGCUAA AAACACACAU AUUAAGCAUA 60 :(((((--(( ((((((-(-( (((((((((( ((-((((((( (--(((((,, ,,,,,,,,,, UUAACUUUUA AAAAGUUCAG CCAAUCAUAA AAGAGACUGU AAAAUAUAAA UAAUCAUAAA 120 ,,,,<<<<<< __________ _______>>> >>>,,,,,,, ,,,,<<<<<< <-------<< GUAUUAAAGU AAUAUAUAAC UUGCAUAAAA ACUUGAAAAC AAUUUAUAGU GUGAAACAAA 180 <<------<< <<________ >>>>------ >>>>------ ->>>>>>>)) )))------- AAAUUUGGUC UAUAACAACU UAUAUUAUAA AACGGAGGAA AUAU 224 ---)))))-) ))-))))))) ))))))-)-) )))))))--) ))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2052_58467+58571_1-22
- gnl|BL_ORD_ID|2052_58467-58571_84-105