IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | UUAUAUUGUAAAACGGAGGGAG |
encoded miRNA: | MIR51 |
Precursor location: | 3185 - 3386 (positive strand) |
precursor length: | 202 (73 basepairs) |
MIR position: | 181 - 202 (3365 - 3386) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr5:14049206>14049407 chr5:14108506>14108707 |
miRNA location TIGR v5: | chr5:14458264>14458465 chr5:14517564>14517765 |
Folding energy: | -58.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster032 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCCUCUGU UUCAUAAUAU AAGUUGUUUU AGACCAAUUU UUUUGUUUUA CAAGAAAAGU 60 (((((((((( ((-((((((( (((((((((( ((,,,,,<<< <<<<<_____ >>>>>>>>,< UAUUUUCUAG UUUCUAUGCA AAUUAUAUGU UACUUUAAUA UUUUAUGAUU ACUUAUAUUA 120 <<<<<<--<< <<<----<<- <<<<<<<-<- -<<<--<<<< ---<<<<<__ __>>>>>->> UUUAGUCUCU UUUAUGAUUG GUUGAACUUU UUCAAAGUAA AUAUUCUUAA CUGAAACAAC 180 >>->>>-->- -->>>>>>>- >>->>>>>-- --->>>>>>> ,,,,,,,,,, )))))))))) ********** ********** ** UUAUAUUGUA AAACGGAGGG AG 202 )))))))))- )))))))))) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At3g53510.1 | 68410.m05466 ABC transporter family protein | 3 | 1 |
Rice homologs
- gnl|BL_ORD_ID|1595_48567+48716_129-150
- gnl|BL_ORD_ID|618_144350+144505_135-156
- gnl|BL_ORD_ID|618_144350-144505_1-22
- gnl|BL_ORD_ID|585_142329+142478_129-150
- gnl|BL_ORD_ID|349_83930-84079_1-22
- gnl|BL_ORD_ID|349_83930+84079_129-150
- gnl|BL_ORD_ID|279_26569-26718_1-22
- gnl|BL_ORD_ID|279_26569+26718_129-150