IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | CUCCCUCCGUUUUACAAUAUAAG |
encoded miRNA: | MIR51p |
Precursor location: | 3185 - 3386 (negative strand) |
precursor length: | 202 (60 basepairs) |
MIR position: | 1 - 23 (3364 - 3386) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr5:14049206<14049407 chr5:14108506<14108707 |
miRNA location TIGR v5: | chr5:14458264<14458465 chr5:14517564<14517765 |
Folding energy: | -45.92 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** CUCCCUCCGU UUUACAAUAU AAGUUGUUUC AGUUAAGAAU AUUUACUUUG AAAAAGUUCA 60 (((((((-(( ((((-((((( (((((((((, ,,,,,,<<<< -<<<______ _>>>->>>>, ACCAAUCAUA AAAGAGACUA AAUAAUAUAA GUAAUCAUAA AAUAUUAAAG UAACAUAUAA 120 ,,,,,,,,,, ,,,,<<<<<< <,[[[[[[__ __________ _]]]]]],,, ,,,,,,,,,, UUUGCAUAGA AACUAGAAAA UAACUUUUCU UGUAAAACAA AAAAAUUGGU CUAAAACAAC 180 [[[[[[-[[[ [[--[[____ ___]]]]]]] ]]]]]],,,, ,,,,,>>>>> >>,))))))) UUAUAUUAUG AAACAGAGGG AG 202 )))))))-)) ))))-))))) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3494_116209+116354_124-146
- gnl|BL_ORD_ID|3494_116209-116354_1-23
- gnl|BL_ORD_ID|3371_67527-67652_1-23
- gnl|BL_ORD_ID|3371_67527+67652_104-126
- gnl|BL_ORD_ID|2045_114741+114866_104-126
- gnl|BL_ORD_ID|2045_114741-114866_1-23