IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUAAAACGGAGGGAG |
encoded miRNA: | MIR51o |
Precursor location: | 3185 - 3386 (positive strand) |
precursor length: | 202 (73 basepairs) |
MIR position: | 180 - 202 (3364 - 3386) |
MIR length: | 23 (22 paired bases) |
miRNA location TIGR v3: | chr5:14049206>14049407 chr5:14108506>14108707 |
miRNA location TIGR v5: | chr5:14458264>14458465 chr5:14517564>14517765 |
Folding energy: | -58.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCCUCUGU UUCAUAAUAU AAGUUGUUUU AGACCAAUUU UUUUGUUUUA CAAGAAAAGU 60 (((((((((( ((-((((((( (((((((((( ((,,,,,<<< <<<<<_____ >>>>>>>>,< UAUUUUCUAG UUUCUAUGCA AAUUAUAUGU UACUUUAAUA UUUUAUGAUU ACUUAUAUUA 120 <<<<<<--<< <<<----<<- <<<<<<<-<- -<<<--<<<< ---<<<<<__ __>>>>>->> * UUUAGUCUCU UUUAUGAUUG GUUGAACUUU UUCAAAGUAA AUAUUCUUAA CUGAAACAAC 180 >>->>>-->- -->>>>>>>- >>->>>>>-- --->>>>>>> ,,,,,,,,,, )))))))))) ********** ********** ** UUAUAUUGUA AAACGGAGGG AG 202 )))))))))- )))))))))) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3494_116209+116354_124-146
- gnl|BL_ORD_ID|3494_116209-116354_1-23
- gnl|BL_ORD_ID|3371_67527-67652_1-23
- gnl|BL_ORD_ID|3371_67527+67652_104-126
- gnl|BL_ORD_ID|2045_114741+114866_104-126
- gnl|BL_ORD_ID|2045_114741-114866_1-23