IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | CCCUCCGUUUUACAAUAUAAG |
encoded miRNA: | MIR51n |
Precursor location: | 3187 - 3384 (negative strand) |
precursor length: | 198 (58 basepairs) |
MIR position: | 1 - 21 (3364 - 3384) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr5:14049208<14049405 chr5:14108508<14108705 |
miRNA location TIGR v5: | chr5:14458266<14458463 chr5:14517566<14517763 |
Folding energy: | -41.42 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * CCCUCCGUUU UACAAUAUAA GUUGUUUCAG UUAAGAAUAU UUACUUUGAA AAAGUUCAAC 60 (((((-(((( ((-((((((( (((((((,,, ,,,,<<<<-< <<_______> >>->>>>,,, CAAUCAUAAA AGAGACUAAA UAAUAUAAGU AAUCAUAAAA UAUUAAAGUA ACAUAUAAUU 120 ,,,,,,,,,, ,,<<<<<<<, [[[[[[____ _________] ]]]]],,,,, ,,,,,,,,[[ UGCAUAGAAA CUAGAAAAUA ACUUUUCUUG UAAAACAAAA AAAUUGGUCU AAAACAACUU 180 [[[[-[[[[[ --[[______ _]]]]]]]]] ]]]],,,,,, ,,,>>>>>>> ,))))))))) AUAUUAUGAA ACAGAGGG 198 )))))-)))) ))-)))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1667_28710-28920_1-21
- gnl|BL_ORD_ID|1667_28710+28920_191-211