IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUAAAACGGAGGG |
encoded miRNA: | MIR51m |
Precursor location: | 3187 - 3384 (positive strand) |
precursor length: | 198 (71 basepairs) |
MIR position: | 178 - 198 (3364 - 3384) |
MIR length: | 21 (20 paired bases) |
miRNA location TIGR v3: | chr5:14049208>14049405 chr5:14108508>14108705 |
miRNA location TIGR v5: | chr5:14458266>14458463 chr5:14517566>14517763 |
Folding energy: | -54.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CCCUCUGUUU CAUAAUAUAA GUUGUUUUAG ACCAAUUUUU UUGUUUUACA AGAAAAGUUA 60 (((((((((( -((((((((( (((((((((( ,,,,,<<<<< <<<_____>> >>>>>>,<<< UUUUCUAGUU UCUAUGCAAA UUAUAUGUUA CUUUAAUAUU UUAUGAUUAC UUAUAUUAUU 120 <<<<--<<<< <----<<-<< <<<<<-<--< <<--<<<<-- -<<<<<____ >>>>>->>>> *** UAGUCUCUUU UAUGAUUGGU UGAACUUUUU CAAAGUAAAU AUUCUUAACU GAAACAACUU 180 ->>>-->--- >>>>>>>->> ->>>>>---- ->>>>>>>,, ,,,,,,,,)) )))))))))) ********** ******** AUAUUGUAAA ACGGAGGG 198 )))))))-)) ))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1667_28710-28920_1-21
- gnl|BL_ORD_ID|1667_28710+28920_191-211