IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | CCUCCGUUUUACAAUAUAAG |
encoded miRNA: | MIR51l |
Precursor location: | 3188 - 3383 (negative strand) |
precursor length: | 196 (57 basepairs) |
MIR position: | 1 - 20 (3364 - 3383) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr5:14049209<14049404 chr5:14108509<14108704 |
miRNA location TIGR v5: | chr5:14458267<14458462 chr5:14517567<14517762 |
Folding energy: | -38.12 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** CCUCCGUUUU ACAAUAUAAG UUGUUUCAGU UAAGAAUAUU UACUUUGAAA AAGUUCAACC 60 ((((-((((( (-(((((((( ((((((,,,, ,,,<<<<-<< <_______>> >->>>>,,,, AAUCAUAAAA GAGACUAAAU AAUAUAAGUA AUCAUAAAAU AUUAAAGUAA CAUAUAAUUU 120 ,,,,,,,,,, ,<<<<<<<,[ [[[[[_____ ________]] ]]]],,,,,, ,,,,,,,[[[ GCAUAGAAAC UAGAAAAUAA CUUUUCUUGU AAAACAAAAA AAUUGGUCUA AAACAACUUA 180 [[[-[[[[[- -[[_______ ]]]]]]]]]] ]]],,,,,,, ,,>>>>>>>, )))))))))) UAUUAUGAAA CAGAGG 196 ))))-))))) )-))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3371_67633+67752_101-120
- gnl|BL_ORD_ID|3371_67633-67752_1-20
- gnl|BL_ORD_ID|2045_114644-114763_1-20
- gnl|BL_ORD_ID|2045_114644+114763_101-120
- gnl|BL_ORD_ID|3458_114689-114785_1-20
- gnl|BL_ORD_ID|3458_114689+114785_78-97
- gnl|BL_ORD_ID|2537_132225+132321_78-97
- gnl|BL_ORD_ID|2537_132225-132321_1-20