IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | CCUCCGUUUUACAAUAUAAGU |
encoded miRNA: | MIR51h |
Precursor location: | 3188 - 3383 (negative strand) |
precursor length: | 196 (57 basepairs) |
MIR position: | 1 - 21 (3363 - 3383) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr5:14049209<14049404 chr5:14108509<14108704 |
miRNA location TIGR v5: | chr5:14458267<14458462 chr5:14517567<14517762 |
Folding energy: | -38.12 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * CCUCCGUUUU ACAAUAUAAG UUGUUUCAGU UAAGAAUAUU UACUUUGAAA AAGUUCAACC 60 ((((-((((( (-(((((((( ((((((,,,, ,,,<<<<-<< <_______>> >->>>>,,,, AAUCAUAAAA GAGACUAAAU AAUAUAAGUA AUCAUAAAAU AUUAAAGUAA CAUAUAAUUU 120 ,,,,,,,,,, ,<<<<<<<,[ [[[[[_____ ________]] ]]]],,,,,, ,,,,,,,[[[ GCAUAGAAAC UAGAAAAUAA CUUUUCUUGU AAAACAAAAA AAUUGGUCUA AAACAACUUA 180 [[[-[[[[[- -[[_______ ]]]]]]]]]] ]]],,,,,,, ,,>>>>>>>, )))))))))) UAUUAUGAAA CAGAGG 196 ))))-))))) )-))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2945_89503-89613_1-21
- gnl|BL_ORD_ID|2945_89502+89613_92-112
- gnl|BL_ORD_ID|1973_68574-68651_1-21
- gnl|BL_ORD_ID|1973_68573+68651_59-79
- gnl|BL_ORD_ID|1540_123980-124184_1-21
- gnl|BL_ORD_ID|1540_123980+124184_185-205
- gnl|BL_ORD_ID|1455_74091+74234_124-144
- gnl|BL_ORD_ID|1455_74091-74234_1-21
- gnl|BL_ORD_ID|1424_118173-118281_1-21
- gnl|BL_ORD_ID|1424_118173+118281_89-109
- gnl|BL_ORD_ID|504_109020+109163_124-144
- gnl|BL_ORD_ID|504_109020-109163_1-21