IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUAAAACGGAG |
encoded miRNA: | MIR51e |
Precursor location: | 3189 - 3382 (positive strand) |
precursor length: | 194 (69 basepairs) |
MIR position: | 175 - 194 (3363 - 3382) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr5:14049210>14049403 chr5:14108510>14108703 |
miRNA location TIGR v5: | chr5:14458268>14458461 chr5:14517568>14517761 |
Folding energy: | -47.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCUGUUUCA UAAUAUAAGU UGUUUUAGAC CAAUUUUUUU GUUUUACAAG AAAAGUUAUU 60 ((((((((-( (((((((((( ((((((((,, ,,,<<<<<<< <_____>>>> >>>>,<<<<< UUCUAGUUUC UAUGCAAAUU AUAUGUUACU UUAAUAUUUU AUGAUUACUU AUAUUAUUUA 120 <<--<<<<<- ---<<-<<<< <<<-<--<<< --<<<<---< <<<<____>> >>>->>>>-> ****** GUCUCUUUUA UGAUUGGUUG AACUUUUUCA AAGUAAAUAU UCUUAACUGA AACAACUUAU 180 >>-->--->> >>>>>->>-> >>>>-----> >>>>>>,,,, ,,,,,,)))) )))))))))) ********** **** AUUGUAAAAC GGAG 194 )))))-)))) ))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|231_28888-28992_1-20
- gnl|BL_ORD_ID|231_28888+28992_86-105