IGR sequence: | igr2835#chr5#x1=14105322#l=9222 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUAAAACGGAGGGAG |
encoded miRNA: | MIR51c |
Precursor location: | 3185 - 3386 (positive strand) |
precursor length: | 202 (73 basepairs) |
MIR position: | 178 - 202 (3362 - 3386) |
MIR length: | 25 (24 paired bases) |
miRNA location TIGR v3: | chr5:14049206>14049407 chr5:14108506>14108707 |
miRNA location TIGR v5: | chr5:14458264>14458465 chr5:14517564>14517765 |
Folding energy: | -58.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCCUCUGU UUCAUAAUAU AAGUUGUUUU AGACCAAUUU UUUUGUUUUA CAAGAAAAGU 60 (((((((((( ((-((((((( (((((((((( ((,,,,,<<< <<<<<_____ >>>>>>>>,< UAUUUUCUAG UUUCUAUGCA AAUUAUAUGU UACUUUAAUA UUUUAUGAUU ACUUAUAUUA 120 <<<<<<--<< <<<----<<- <<<<<<<-<- -<<<--<<<< ---<<<<<__ __>>>>>->> *** UUUAGUCUCU UUUAUGAUUG GUUGAACUUU UUCAAAGUAA AUAUUCUUAA CUGAAACAAC 180 >>->>>-->- -->>>>>>>- >>->>>>>-- --->>>>>>> ,,,,,,,,,, )))))))))) ********** ********** ** UUAUAUUGUA AAACGGAGGG AG 202 )))))))))- )))))))))) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3481_110396-110525_1-25
- gnl|BL_ORD_ID|3481_110396+110525_106-130
- gnl|BL_ORD_ID|3416_49160+49309_126-150
- gnl|BL_ORD_ID|3273_63638+63794_133-157
- gnl|BL_ORD_ID|3273_63638-63794_1-25
- gnl|BL_ORD_ID|3084_165764+165844_57-81
- gnl|BL_ORD_ID|3084_165764-165844_1-25
- gnl|BL_ORD_ID|2119_136405+136522_94-118
- gnl|BL_ORD_ID|2119_136405-136522_1-25
- gnl|BL_ORD_ID|1979_168071-168222_1-25
- gnl|BL_ORD_ID|1156_28115+28195_57-81
- gnl|BL_ORD_ID|1156_28115-28195_1-25
- gnl|BL_ORD_ID|915_42760-42916_1-25
- gnl|BL_ORD_ID|915_42760+42916_133-157
- gnl|BL_ORD_ID|149_133300+133449_126-150
- gnl|BL_ORD_ID|62_48372+48521_126-150