IGR sequence: | igr2826#chr5#x1=14046022#l=5701 |
---|---|
Mature miRNA sequence: | CUCCGUUUUACAAUAUAAGU |
encoded miRNA: | MIR51f |
Precursor location: | 3189 - 3382 (negative strand) |
precursor length: | 194 (56 basepairs) |
MIR position: | 1 - 20 (3363 - 3382) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr5:14049210<14049403 chr5:14108510<14108703 |
miRNA location TIGR v5: | chr5:14458268<14458461 chr5:14517568<14517761 |
Folding energy: | -34.82 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** CUCCGUUUUA CAAUAUAAGU UGUUUCAGUU AAGAAUAUUU ACUUUGAAAA AGUUCAACCA 60 (((-(((((( -((((((((( (((((,,,,, ,,<<<<-<<< _______>>> ->>>>,,,,, AUCAUAAAAG AGACUAAAUA AUAUAAGUAA UCAUAAAAUA UUAAAGUAAC AUAUAAUUUG 120 ,,,,,,,,,, <<<<<<<,[[ [[[[______ _______]]] ]]],,,,,,, ,,,,,,[[[[ CAUAGAAACU AGAAAAUAAC UUUUCUUGUA AAACAAAAAA AUUGGUCUAA AACAACUUAU 180 [[-[[[[[-- [[_______] ]]]]]]]]]] ]],,,,,,,, ,>>>>>>>,) )))))))))) AUUAUGAAAC AGAG 194 )))-)))))) -)))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|231_28888-28992_1-20
- gnl|BL_ORD_ID|231_28888+28992_86-105