IGR sequence: | igr2826#chr5#x1=14046022#l=5701 |
---|---|
Mature miRNA sequence: | AACAACUUAUAUUGUAAAACGGAGG |
encoded miRNA: | MIR51a |
Precursor location: | 3188 - 3383 (positive strand) |
precursor length: | 196 (70 basepairs) |
MIR position: | 172 - 196 (3359 - 3383) |
MIR length: | 25 (24 paired bases) |
miRNA location TIGR v3: | chr5:14049209>14049404 chr5:14108509>14108704 |
miRNA location TIGR v5: | chr5:14458267>14458462 chr5:14517567>14517762 |
Folding energy: | -51.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CCUCUGUUUC AUAAUAUAAG UUGUUUUAGA CCAAUUUUUU UGUUUUACAA GAAAAGUUAU 60 (((((((((- (((((((((( (((((((((, ,,,,<<<<<< <<_____>>> >>>>>,<<<< UUUCUAGUUU CUAUGCAAAU UAUAUGUUAC UUUAAUAUUU UAUGAUUACU UAUAUUAUUU 120 <<<--<<<<< ----<<-<<< <<<<-<--<< <--<<<<--- <<<<<____> >>>>->>>>- ********* AGUCUCUUUU AUGAUUGGUU GAACUUUUUC AAAGUAAAUA UUCUUAACUG AAACAACUUA 180 >>>-->---> >>>>>>->>- >>>>>----- >>>>>>>,,, ,,,,,,,))) )))))))))) ********** ****** UAUUGUAAAA CGGAGG 196 ))))))-))) ))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3092_30741-30884_1-25
- gnl|BL_ORD_ID|3092_30741+30884_120-144
- gnl|BL_ORD_ID|381_107422-107565_1-25
- gnl|BL_ORD_ID|381_107422+107565_120-144