IGR sequence: | igr2826#chr5#x1=14046022#l=5701 |
---|---|
Mature miRNA sequence: | ACUUAUAUUAUGAAACAGAGGGA |
encoded miRNA: | MIR25g |
Precursor location: | 3186 - 3385 (negative strand) |
precursor length: | 200 (59 basepairs) |
MIR position: | 178 - 200 (3186 - 3208) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr5:14049207<14049406 chr5:14108507<14108706 |
miRNA location TIGR v5: | chr5:14458265<14458464 chr5:14517565<14517764 |
Folding energy: | -43.32 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCCUCCGUU UUACAAUAUA AGUUGUUUCA GUUAAGAAUA UUUACUUUGA AAAAGUUCAA 60 ((((((-((( (((-(((((( ((((((((,, ,,,,,<<<<- <<<_______ >>>->>>>,, CCAAUCAUAA AAGAGACUAA AUAAUAUAAG UAAUCAUAAA AUAUUAAAGU AACAUAUAAU 120 ,,,,,,,,,, ,,,<<<<<<< ,[[[[[[___ __________ ]]]]]],,,, ,,,,,,,,,[ *** UUGCAUAGAA ACUAGAAAAU AACUUUUCUU GUAAAACAAA AAAAUUGGUC UAAAACAACU 180 [[[[[-[[[[ [--[[_____ __]]]]]]]] ]]]]],,,,, ,,,,>>>>>> >,)))))))) ********** ********** UAUAUUAUGA AACAGAGGGA 200 ))))))-))) )))-))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2115_140946+141136_1-23
- gnl|BL_ORD_ID|2115_140946-141136_169-191