IGR sequence: | igr2826#chr5#x1=14046022#l=5701 |
---|---|
Mature miRNA sequence: | UCCCUCUGUUUCAUAAUAUAAGU |
encoded miRNA: | MIR25f |
Precursor location: | 3186 - 3385 (positive strand) |
precursor length: | 200 (72 basepairs) |
MIR position: | 1 - 23 (3186 - 3208) |
MIR length: | 23 (22 paired bases) |
miRNA location TIGR v3: | chr5:14049207>14049406 chr5:14108507>14108706 |
miRNA location TIGR v5: | chr5:14458265>14458464 chr5:14517565>14517764 |
Folding energy: | -56.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** UCCCUCUGUU UCAUAAUAUA AGUUGUUUUA GACCAAUUUU UUUGUUUUAC AAGAAAAGUU 60 (((((((((( (-(((((((( (((((((((( (,,,,,<<<< <<<<_____> >>>>>>>,<< AUUUUCUAGU UUCUAUGCAA AUUAUAUGUU ACUUUAAUAU UUUAUGAUUA CUUAUAUUAU 120 <<<<<--<<< <<----<<-< <<<<<<-<-- <<<--<<<<- --<<<<<___ _>>>>>->>> UUAGUCUCUU UUAUGAUUGG UUGAACUUUU UCAAAGUAAA UAUUCUUAAC UGAAACAACU 180 >->>>-->-- ->>>>>>>-> >->>>>>--- -->>>>>>>, ,,,,,,,,,) )))))))))) UAUAUUGUAA AACGGAGGGA 200 ))))))))-) ))))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2115_140946+141136_1-23
- gnl|BL_ORD_ID|2115_140946-141136_169-191