IGR sequence: | igr2739#chr4#x1=13510141#l=1559 |
---|---|
Mature miRNA sequence: | CAAAAGAGAUAGUGUUUUUG |
encoded miRNA: | MIR2 |
Precursor location: | 893 - 1173 (negative strand) |
precursor length: | 281 (91 basepairs) |
MIR position: | 1 - 20 (1154 - 1173) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr4:13511033<13511313 |
miRNA location TIGR v5: | chr4:14546039<14546319 |
Folding energy: | -77.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster014 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** CAAAAGAGAU AGUGUUUUUG AUGGACUUAA AAGUGAUGGU GUUGACAAAU AUGGUGCUUA 60 ((((-((((( -(-((((((( ,<<<<---<< <<<<<<---- -<<<<----- <<<<-<<<<< UGAAGCAAGU GCGGCAGUGA GAAGGGAUUG AGGAUUUGAG UUGCAGAAAA AAUUGUUGAC 120 <<,,[[____ ]],[[[-[[[ ---[[[[[[[ [[[,,,,,,{ {{{{{{____ _____}}}-} AACGAUGGUG UUGUUAUCAA CACUAUAACC UCUAACAAGG GGUAAAACCG UCAUAUCCCC 180 }}},{{{{{{ {{{____}}} }}}}}},{{{ {{{____}}} }}},,,,]]- ]]]-]]]]]- UAUCAAUAUA UGCUUAUUUC CAUAAGUCCA UUCAAAAAAU UCAUUUUUUC UAAUUAUUGG 240 --]]]----- ]]],,,,,,, >>>>>>>>>> >>>>>----- >>>>>>>>>> >>,,,{{{{{ GCUAAAAUGU GUCCAAUCUU ACAAAAGCCC CAUCUUAUUU G 281 {{________ }}}}}}},,, ,)))))))-) -)))))-))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At4g04910.1 | 68411.m00626 component of vesicle-mediated transport -related | 2 | 1 |
Rice homologs
- gnl|BL_ORD_ID|2918_32807-32972_1-20
- gnl|BL_ORD_ID|2775_113543-113708_1-20