IGR sequence: | igr2700#chr5#x1=13210713#l=32091 |
---|---|
Mature miRNA sequence: | AAGUUCAAGAAAGCUGUGGAAA |
encoded miRNA: | MIR60 |
Precursor location: | 9267 - 9383 (negative strand) |
precursor length: | 117 (38 basepairs) |
MIR position: | 96 - 117 (9267 - 9288) |
MIR length: | 22 (18 paired bases) |
miRNA location TIGR v3: | chr5:13219979<13220095 |
miRNA location TIGR v5: | chr5:13629037<13629153 |
Folding energy: | -39.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster004 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUCCCACAGC UUUCUUGAGC UUCCAAAAUG CUUAAUCUUA AAGUUUUUUU UCUUCUUACU 60 :::((((((( (((((((((( (((((,,,,< <<<_______ >>>><<<<<< <<<<---<<_ ***** ********** ******* UUUGUUUAAG AAAAAAACAA UGGAAAUGAA AAAGAAAGUU CAAGAAAGCU GUGGAAA 117 ___>>-->>> >>>>>>>,,, ))))------ ------)))) )))))))))) )))):::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g68450.1 | 68408.m07175 expressed protein | 3 | 1 |
Rice homologs
- gnl|BL_ORD_ID|1525_12976+13098_1-22
- gnl|BL_ORD_ID|1525_12976-13098_102-123
- gnl|BL_ORD_ID|393_115431+115553_1-22
- gnl|BL_ORD_ID|393_115431-115553_102-123