IGR sequence: | igr2700#chr5#x1=13210713#l=32091 |
---|---|
Mature miRNA sequence: | UUUCCACAGCUUUCUUGAACUU |
encoded miRNA: | MIR59 |
Precursor location: | 9267 - 9383 (positive strand) |
precursor length: | 117 (36 basepairs) |
MIR position: | 1 - 22 (9267 - 9288) |
MIR length: | 22 (20 paired bases) |
miRNA location TIGR v3: | chr5:13219979>13220095 |
miRNA location TIGR v5: | chr5:13629037>13629153 |
Folding energy: | -39.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster035 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UUUCCACAGC UUUCUUGAAC UUUCUUUUUC AUUUCCAUUG UUUUUUUCUU AAACAAAAGU 60 :((((((((( ((((((((-( ((((,,,,,, ,,,,,,,,,, <<<<<<<<<< <________> AAGAAGAAAA AAAACUUUAA GAUUAAGCAU UUUGGAAGCU CAAGAAAGCU GUGGGAA 117 >>>>>>>>>> ,,,,<<<___ ____>>>,,, ,,,)))))-) )))))))))) )))))):
![](../images/prec6560.png)
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At5g61440.1 | 68412.m06974 thioredoxin family | 3 | 1 |
Rice homologs
- gnl|BL_ORD_ID|1525_12976+13098_1-22
- gnl|BL_ORD_ID|1525_12976-13098_102-123
- gnl|BL_ORD_ID|393_115431+115553_1-22
- gnl|BL_ORD_ID|393_115431-115553_102-123