IGR sequence: | igr2585#chr1#x1=11134319#l=5910 |
---|---|
Mature miRNA sequence: | UGAAGCUGCCAGCAUGAUCUGGU |
encoded miRNA: | MIR36c |
Precursor location: | 3219 - 3560 (positive strand) |
precursor length: | 342 (116 basepairs) |
MIR position: | 1 - 23 (3219 - 3241) |
MIR length: | 23 (20 paired bases) |
miRNA location TIGR v3: | chr1:11137537>11137878 |
miRNA location TIGR v5: | chr1:11137537>11137878 |
Folding energy: | -108.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** UGAAGCUGCC AGCAUGAUCU GGUAAUCGCU ACAUACGACA UACACACAUC ACUAAACUUC 60 :((((((((- ((-((((((( ((((---((( (--((-(((( ((((((((-( (((,,,,,,, UUUAUAAUUU AUGCACACAC AUACAGCUCU UAAUGGCCAC AACUCAAAGU UAUAAUUAGU 120 ,,<<_____> >,,,<<<<<< <<<<,[[[__ ____]]],,, ,,,,,,,[[[ [[[[[[[[[- GCAUGAUCUC UAGUUAUUUG ACUGCUUUUA AUAUAUGUUU AUGGAUUCAC GCAUGUGUGU 180 [______]-] ]]]]]]]--] ]]],,,,,,, [[[[[[[[[[ [[[,,,,,{{ {{{-{{{{{{ GUAUGUACAU AAUUUACAUG CAUGCACUUU GUGUAUGGUA CACAUCAAUU UGAACCCGUU 240 {{{{{{{___ ____}}}}}} }}}}}}}--} }}}},{{{{{ -{{{----{{ {{{{____}} CAAAAUUCUG UUUUUAUUAG UAUAUAUAUA GAUGUAUGUG GUGUGUGUGU CAGUGUGUGU 300 }}}}----}} }---}}}}}, ,,,,,,]]]] ]]]]]]]]], >>>>>>>>>> ,))))))))) GUGUGUUUAU AGAUAGUAGU ACUAGGUCAU CCUGCAGCUU CA 342 )))))))--) )--))))--) )))))))))) -))))))))) ):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1538_57251+57503_1-23