IGR sequence: | igr2585#chr1#x1=11134319#l=5910 |
---|---|
Mature miRNA sequence: | GCUGAAGCUGCCAGCAUGAUCUGGU |
encoded miRNA: | MIR36b |
Precursor location: | 3217 - 3562 (positive strand) |
precursor length: | 346 (119 basepairs) |
MIR position: | 1 - 25 (3217 - 3241) |
MIR length: | 25 (23 paired bases) |
miRNA location TIGR v3: | chr1:11137535>11137880 |
miRNA location TIGR v5: | chr1:11137535>11137880 |
Folding energy: | -112.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** GCUGAAGCUG CCAGCAUGAU CUGGUAAUCG CUACAUACGA CAUACACACA UCACUAAACU 60 (((((((((( (-((-((((( ((((((---( (((--((-(( (((((((((( -((((,,,,, UCUUUAUAAU UUAUGCACAC ACAUACAGCU CUUAAUGGCC ACAACUCAAA GUUAUAAUUA 120 ,,,,<<____ _>>,,,<<<< <<<<<<,[[[ ______]]], ,,,,,,,,,[ [[[[[[[[[[ GUGCAUGAUC UCUAGUUAUU UGACUGCUUU UAAUAUAUGU UUAUGGAUUC ACGCAUGUGU 180 [-[______] -]]]]]]]]- -]]]],,,,, ,,[[[[[[[[ [[[[[,,,,, {{{{{-{{{{ GUGUAUGUAC AUAAUUUACA UGCAUGCACU UUGUGUAUGG UACACAUCAA UUUGAACCCG 240 {{{{{{{{{_ ______}}}} }}}}}}}}}- -}}}}},{{{ {{-{{{---- {{{{{{____ UUCAAAAUUC UGUUUUUAUU AGUAUAUAUA UAGAUGUAUG UGGUGUGUGU GUCAGUGUGU 300 }}}}}}---- }}}---}}}} },,,,,,,]] ]]]]]]]]]] ],>>>>>>>> >>,))))))) GUGUGUGUUU AUAGAUAGUA GUACUAGGUC AUCCUGCAGC UUCAGU 346 )))))))))- -))--))))- -))))))))) ))-))))))) ))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|115_33931+34115_1-25
- gnl|BL_ORD_ID|113_32017+32201_1-25