IGR sequence: | igr2585#chr1#x1=11134319#l=5910 |
---|---|
Mature miRNA sequence: | AGCUGAAGCUGCCAGCAUGAUCUG |
encoded miRNA: | MIR36a |
Precursor location: | 3216 - 3562 (positive strand) |
precursor length: | 347 (119 basepairs) |
MIR position: | 1 - 24 (3216 - 3239) |
MIR length: | 24 (21 paired bases) |
miRNA location TIGR v3: | chr1:11137534>11137880 |
miRNA location TIGR v5: | chr1:11137534>11137880 |
Folding energy: | -113.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** AGCUGAAGCU GCCAGCAUGA UCUGGUAAUC GCUACAUACG ACAUACACAC AUCACUAAAC 60 :((((((((( ((-((-(((( (((((((--- ((((--((-( (((((((((( (-((((,,,, UUCUUUAUAA UUUAUGCACA CACAUACAGC UCUUAAUGGC CACAACUCAA AGUUAUAAUU 120 ,,,,,<<___ __>>,,,<<< <<<<<<<,[[ [______]]] ,,,,,,,,,, [[[[[[[[[[ AGUGCAUGAU CUCUAGUUAU UUGACUGCUU UUAAUAUAUG UUUAUGGAUU CACGCAUGUG 180 [[-[______ ]-]]]]]]]] --]]]],,,, ,,,[[[[[[[ [[[[[[,,,, ,{{{{{-{{{ UGUGUAUGUA CAUAAUUUAC AUGCAUGCAC UUUGUGUAUG GUACACAUCA AUUUGAACCC 240 {{{{{{{{{{ _______}}} }}}}}}}}}} --}}}}},{{ {{{-{{{--- -{{{{{{___ GUUCAAAAUU CUGUUUUUAU UAGUAUAUAU AUAGAUGUAU GUGGUGUGUG UGUCAGUGUG 300 _}}}}}}--- -}}}---}}} }},,,,,,,] ]]]]]]]]]] ]],>>>>>>> >>>,)))))) UGUGUGUGUU UAUAGAUAGU AGUACUAGGU CAUCCUGCAG CUUCAGU 347 )))))))))) --))--)))) --)))))))) )))-)))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1303_42235-42344_87-110
- gnl|BL_ORD_ID|1303_42235+42344_1-24