IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | UAGCCAAGGAUGACUUGCCUG |
encoded miRNA: | MIR43a |
Precursor location: | 7800 - 7946 (negative strand) |
precursor length: | 147 (53 basepairs) |
MIR position: | 1 - 21 (7926 - 7946) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr3:9879811<9879957 |
miRNA location TIGR v5: | chr3:9879801<9879947 |
Folding energy: | -55.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * UAGCCAAGGA UGACUUGCCU GAUCUUUUUC GCCUCCACGA UUCAAUUUCA AAUUCAUGCA 60 (((((((((( -((((-(((( ((-(((---- ((((-((-(( (((((----- ----((((-- UUUUGGAUUA UUAUACCUUU UAAAGUAUAA UAGGUCAAAU AUCAUGUUGA AUCUUGCGGG 120 -((((--((( ((((((____ ____)))))) )))--))))- --)))))))) )))-))-))) UUAGGUUUCA GGCAGUCUCU UUGGCUA 147 )-)))--))) )))))))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3514_22768-22902_1-21
- gnl|BL_ORD_ID|3514_22768+22902_115-135
- gnl|BL_ORD_ID|3443_22768-22902_1-21
- gnl|BL_ORD_ID|3443_22768+22902_115-135
- gnl|BL_ORD_ID|2878_52360+52494_115-135
- gnl|BL_ORD_ID|2878_52360-52494_1-21
- gnl|BL_ORD_ID|2113_133631-133718_1-21
- gnl|BL_ORD_ID|2113_133631+133718_68-88
- gnl|BL_ORD_ID|990_72926-73013_1-21
- gnl|BL_ORD_ID|990_72926+73013_68-88