IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | AGGCAAGUCAUCCUUGGCUACCA |
encoded miRNA: | MIR62 |
Precursor location: | 7445 - 7577 (positive strand) |
precursor length: | 133 (49 basepairs) |
MIR position: | 111 - 133 (7555 - 7577) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr3:9879456>9879588 |
miRNA location TIGR v5: | chr3:9879446>9879578 |
Folding energy: | -54.01 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAUAGCCAAG GAGACUGCCU GAUGUCUUUU GAUGAGUAAA AUGGUCAUUG CUUGAUAUAA 60 (-(((((((( (((((((((( (---((((-- --(((((((( ((((((((-( -((((((--( ********** CUUAUAGUCA CUUGUCAAAC AUGACACUAA CCCAUUUUAC UCAAAGAAAC AGGCAAGUCA 120 (_____))-- --))))))-) ))))------ -))))))))) )))))))--) ))))-))))- ********** *** UCCUUGGCUA CCA 133 )))))))))) -):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2510_67219-67328_1-23
- gnl|BL_ORD_ID|2510_67219+67328_88-110