IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | ACAGGCAAGUCAUCCUUGGCUA |
encoded miRNA: | MIR47a |
Precursor location: | 7447 - 7574 (positive strand) |
precursor length: | 128 (48 basepairs) |
MIR position: | 107 - 128 (7553 - 7574) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr3:9879458>9879585 |
miRNA location TIGR v5: | chr3:9879448>9879575 |
Folding energy: | -52.91 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGCCAAGGA GACUGCCUGA UGUCUUUUGA UGAGUAAAAU GGUCAUUGCU UGAUAUAACU 60 (((((((((( (((((((((- --((((---- (((((((((( ((((((-(-( (((((--((_ **** ********** UAUAGUCACU UGUCAAACAU GACACUAACC CAUUUUACUC AAAGAAACAG GCAAGUCAUC 120 ____))---- ))))))-))) ))-------) )))))))))) )))))--))) ))-))))-)) ******** CUUGGCUA 128 ))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3514_22769-22903_1-22
- gnl|BL_ORD_ID|3514_22769+22903_114-135
- gnl|BL_ORD_ID|3443_22769-22903_1-22
- gnl|BL_ORD_ID|3443_22769+22903_114-135
- gnl|BL_ORD_ID|2878_52360+52494_114-135
- gnl|BL_ORD_ID|2878_52360-52494_1-22
- gnl|BL_ORD_ID|2113_133632-133719_1-22
- gnl|BL_ORD_ID|990_72927-73014_1-22