IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | CAGGCAAGUCAUCCUUGGCUAU |
encoded miRNA: | MIR56a |
Precursor location: | 5149 - 5297 (positive strand) |
precursor length: | 149 (42 basepairs) |
MIR position: | 128 - 149 (5276 - 5297) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr3:9877160>9877308 |
miRNA location TIGR v5: | chr3:9877150>9877298 |
Folding energy: | -38.56 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AUAGCCAAAG AGACUGCCUG AAACCUAACC CGCAAGAUUC AACAUGAUCU CAAAUUAUUA 60 ((((((((-( (((((((((( (------((( --((-((((( ((,,<<____ >>,<<<<<<< UACCUUUUAA ACGCAUAAUA AUCCAAAAUC CACGAACUUA AAAUUGAAUC AUGGAGGUGA 120 <_________ ____>>>>>> >>,,,,,,,, ,,,,,,,,,, ,,,))))))) -))--)))-- *** ********** ********* AAAAGAUCAG GCAAGUCAUC CUUGGCUAU 149 ------)))) ))-))))-)) -))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3514_22767-22902_1-22
- gnl|BL_ORD_ID|3514_22767+22902_115-136
- gnl|BL_ORD_ID|3443_22767-22902_1-22
- gnl|BL_ORD_ID|3443_22767+22902_115-136
- gnl|BL_ORD_ID|2878_52360+52495_115-136
- gnl|BL_ORD_ID|2878_52360-52495_1-22
- gnl|BL_ORD_ID|2113_133630-133718_1-22
- gnl|BL_ORD_ID|990_72925-73013_1-22