IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | UAGCCAAGGAUGACUUGCCUG |
encoded miRNA: | MIR43a |
Precursor location: | 5150 - 5296 (negative strand) |
precursor length: | 147 (54 basepairs) |
MIR position: | 1 - 21 (5276 - 5296) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr3:9877161<9877307 |
miRNA location TIGR v5: | chr3:9877151<9877297 |
Folding energy: | -61.44 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * UAGCCAAGGA UGACUUGCCU GAUCUUUUUC ACCUCCAUGA UUCAAUUUUA AGUUCGUGGA 60 (((((((((( -((((-(((( ((-(((---- ((((-((-(( ((((((---- --------(( UUUUGGAUUA UUAUGCGUUU AAAAGGUAUA AUAAUUUGAG AUCAUGUUGA AUCUUGCGGG 120 (((--((((( ((((((-(__ ___)-))))) ))))))--)) )))--))))) )))-))-))) UUAGGUUUCA GGCAGUCUCU UUGGCUA 147 )-)))--))) )))))))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3514_19527-19630_1-21
- gnl|BL_ORD_ID|3514_19527+19630_84-104
- gnl|BL_ORD_ID|3443_19527-19630_1-21
- gnl|BL_ORD_ID|3443_19527+19630_84-104
- gnl|BL_ORD_ID|2878_55663+55766_84-104
- gnl|BL_ORD_ID|2878_55663-55766_1-21
- gnl|BL_ORD_ID|2113_123479-123579_1-21
- gnl|BL_ORD_ID|2113_123479+123579_81-101
- gnl|BL_ORD_ID|2113_119292-119379_1-21
- gnl|BL_ORD_ID|2113_119292+119379_68-88
- gnl|BL_ORD_ID|2113_130011-130127_1-21
- gnl|BL_ORD_ID|2113_130011+130127_97-117
- gnl|BL_ORD_ID|990_62774-62874_1-21
- gnl|BL_ORD_ID|990_62774+62874_81-101
- gnl|BL_ORD_ID|990_58587-58674_1-21
- gnl|BL_ORD_ID|990_58587+58674_68-88
- gnl|BL_ORD_ID|990_69306-69422_1-21
- gnl|BL_ORD_ID|990_69306+69422_97-117