IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | CAGGCAAGUCAUCCUUGGCUACCA |
encoded miRNA: | MIR62a |
Precursor location: | 4804 - 4934 (positive strand) |
precursor length: | 131 (42 basepairs) |
MIR position: | 108 - 131 (4911 - 4934) |
MIR length: | 24 (20 paired bases) |
miRNA location TIGR v3: | chr3:9876815>9876945 |
miRNA location TIGR v5: | chr3:9876805>9876935 |
Folding energy: | -51.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAUAGCCAAG GAGACUGCCU GAUGUCUAUU UAUAAACAAA AUGGUCAUUU CUUGGUAUAA 60 (-(((((((( (((((((((( (---(((--- ----(((((( ((((((,,,, ,,,,<<<___ *** ********** CUUAUAGUCA CUUCAAAACA UGACAUCGAC CAUUUUGUUC AGAGAAGCAG GCAAGUCAUC 120 __>>>,<<<< __________ >>>>,,,))) )))))))))- --)))--))) ))-))))-)) ********** * CUUGGCUACC A 131 ))))))))-) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3514_19522-19630_1-24
- gnl|BL_ORD_ID|3514_19522+19630_86-109
- gnl|BL_ORD_ID|3443_19522-19630_1-24
- gnl|BL_ORD_ID|3443_19522+19630_86-109
- gnl|BL_ORD_ID|2878_55661+55769_86-109
- gnl|BL_ORD_ID|2878_55661-55769_1-24
- gnl|BL_ORD_ID|2113_130006-130127_1-24
- gnl|BL_ORD_ID|2113_130006+130127_99-122
- gnl|BL_ORD_ID|2113_123474-123579_1-24
- gnl|BL_ORD_ID|2113_119287-119379_1-24
- gnl|BL_ORD_ID|990_69301-69422_1-24
- gnl|BL_ORD_ID|990_69301+69422_99-122
- gnl|BL_ORD_ID|990_62769-62874_1-24
- gnl|BL_ORD_ID|990_58582-58674_1-24