IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | AGGCAAGUCAUCCUUGGCUACCA |
encoded miRNA: | MIR62 |
Precursor location: | 1235 - 1365 (positive strand) |
precursor length: | 131 (42 basepairs) |
MIR position: | 109 - 131 (1343 - 1365) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr3:9873246>9873376 |
miRNA location TIGR v5: | chr3:9873236>9873366 |
Folding energy: | -48.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAUAGCCAAG GAGACUGCCU GAUAUCUUUU UUAUAAGCAA AAUGGUCAUU GCUUGAUACA 60 (-(((((((( (((((((((( (((-(((((, ,,,<<<<<<< ________>> >>>>>,,,,, ** ********** ACUUAUAGUG ACUUCAAACA AGACACUAAA CAUUUUACAC AAAGAGUCAG GCAAGUCAUC 120 ,,,,,<<<<< -<<<_____> >>->>>>>,, ,,,,,,,,,, )))))))))) ))-))))-)) ********** * CUUGGCUACC A 131 ))))))))-) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2510_67219-67328_1-23
- gnl|BL_ORD_ID|2510_67219+67328_88-110