IGR sequence: | igr2179#chr5#x1=9830792#l=1288 |
---|---|
Mature miRNA sequence: | AUGGAUGUCAUUAUCCAUCAUU |
encoded miRNA: | MIR71 |
Precursor location: | 776 - 942 (negative strand) |
precursor length: | 167 (57 basepairs) |
MIR position: | 1 - 22 (921 - 942) |
MIR length: | 22 (17 paired bases) |
miRNA location TIGR v3: | chr5:9831567<9831733 |
miRNA location TIGR v5: | chr5:9872647<9872813 |
Folding energy: | -46.59 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** AUGGAUGUCA UUAUCCAUCA UUCAUCUCUA UCCAUAAGAU AUGGAUGAUG UUUAUCCAUU 60 (((((((-(( ((((((((-- ---((((--- -----(((-- ((((((((-- -((((((((- AUUUCUUCCU UAAGAUAUAG AUGAUGUUUA UCCAUUAUUU CCUUCUUAAA AUAUGGAUGA 120 ((((------ (((((---(( ((((((____ __)))))))) ---))))))) )))))))))) UGUUUAUCCA UUACUUCAUC UUUAAGAUAU GGAUGAUGUU UAUCCAU 167 ---))))))) )--)))---- ----)))))) ))))))))-- )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2941_106224-106423_1-22