IGR sequence: | igr2174#chr5#x1=9803029#l=11421 |
---|---|
Mature miRNA sequence: | GCACGUGCCCUGCUUCUCCA |
encoded miRNA: | MIR83 |
Precursor location: | 8580 - 8661 (negative strand) |
precursor length: | 82 (27 basepairs) |
MIR position: | 63 - 82 (8580 - 8599) |
MIR length: | 20 (16 paired bases) |
miRNA location TIGR v3: | chr5:9811608<9811689 |
miRNA location TIGR v5: | chr5:9852688<9852769 |
Folding energy: | -32.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster024 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UGGAGUAGUA GAACACGUGC GAAAAUAUGA UCAACAAGUA CCGAUCGAUU UCAUUUGUGU 60 :((((-(((( (--((((((( (((-(((((( ((________ __)))))--- -----)))-) ******** ********** ** UCGCACGUGC CCUGCUUCUC CA 82 )))))))))- -)))))-))) ):
![](../images/prec4160.png)
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g56000.1 | 68408.m05886 amine oxidase-related | 1 | 1 |
Rice homologs
- gnl|BL_ORD_ID|3113_155064-155156_74-93
- gnl|BL_ORD_ID|3113_155064+155156_1-20
- gnl|BL_ORD_ID|968_113710+113831_1-20
- gnl|BL_ORD_ID|968_113710-113831_103-122
- gnl|BL_ORD_ID|396_77782-77855_55-74
- gnl|BL_ORD_ID|396_77782+77855_1-20