IGR sequence: | igr216#chr2#x1=1039061#l=1163 |
---|---|
Mature miRNA sequence: | UGUGUUCUCAGGUCACCCCUUUG |
encoded miRNA: | MIR1 |
Precursor location: | 883 - 971 (positive strand) |
precursor length: | 89 (30 basepairs) |
MIR position: | 67 - 89 (949 - 971) |
MIR length: | 23 (20 paired bases) |
miRNA location TIGR v3: | chr2:1039943>1040031 |
miRNA location TIGR v5: | chr2:1040943>1041031 |
Folding energy: | -36.24 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster031 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CAAAGGAGUG GCAUGUGAAC ACAUAUCCUA UGGUUUCUUC AAAUUUCCAU UGAAACCAUU 60 ((((((-((( ((-((-(((( (((--((--( (((((((___ __________ _))))))))- **** ********** ********* GAGUUUUGUG UUCUCAGGUC ACCCCUUUG 89 ))----)))) )))-))-))) ))-))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g08830.1 | 68408.m00884 copper/zinc superoxidase dismutase (CSD1) | 3 | 1 |
Rice homologs
- gnl|BL_ORD_ID|1328_130435-130533_1-23
- gnl|BL_ORD_ID|1328_130435+130533_77-99