IGR sequence: | igr2102#chr2#x1=10621377#l=6616 |
---|---|
Mature miRNA sequence: | GUGUGCUCACUCUCUUCUGUCA |
encoded miRNA: | MIR17c |
Precursor location: | 3562 - 3643 (positive strand) |
precursor length: | 82 (32 basepairs) |
MIR position: | 61 - 82 (3622 - 3643) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr2:10624938>10625019 |
miRNA location TIGR v5: | chr2:10683551>10683632 |
Folding energy: | -43.00 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR156a |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UGACAGAAAG AGCAGUGAGC ACGCAAGAGA AGCAAGUGCA AUGAUAUGCA AAUUGCCUUU 60 :(((((((-( ((-((((((( (((((((--- -((((-(((( ______)))) --))))-))) ********** ********** ** GUGUGCUCAC UCUCUUCUGU CA 82 )))))))))) )))))))))) ):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2522_50865-50950_1-22
- gnl|BL_ORD_ID|2522_50865+50950_65-86
- gnl|BL_ORD_ID|640_18719-18804_1-22
- gnl|BL_ORD_ID|640_18719+18804_65-86
- gnl|BL_ORD_ID|2458_35999+36087_68-89
- gnl|BL_ORD_ID|2458_35999-36087_1-22
- gnl|BL_ORD_ID|2094_35660-35745_1-22
- gnl|BL_ORD_ID|2094_35660+35745_65-86
- gnl|BL_ORD_ID|2094_35665+35745_60-81
- gnl|BL_ORD_ID|2094_35499-35745_1-22
- gnl|BL_ORD_ID|2094_35500-35745_1-22
- gnl|BL_ORD_ID|1148_144400+144488_68-89
- gnl|BL_ORD_ID|1148_144400-144488_1-22
- gnl|BL_ORD_ID|342_115838-115921_1-22
- gnl|BL_ORD_ID|342_115838+115921_63-84
- gnl|BL_ORD_ID|342_115843+115921_58-79
- gnl|BL_ORD_ID|342_115786+115921_115-136
- gnl|BL_ORD_ID|62_958-1204_1-22
- gnl|BL_ORD_ID|62_959-1204_1-22
- gnl|BL_ORD_ID|62_1119+1204_65-86
- gnl|BL_ORD_ID|62_1124+1204_60-81
- gnl|BL_ORD_ID|62_1119-1204_1-22