IGR sequence: | igr2102#chr2#x1=10621377#l=6616 |
---|---|
Mature miRNA sequence: | GCGUGCUCACUGCUCUUUCUGUCA |
encoded miRNA: | MIR68a |
Precursor location: | 3562 - 3643 (negative strand) |
precursor length: | 82 (32 basepairs) |
MIR position: | 59 - 82 (3562 - 3585) |
MIR length: | 24 (20 paired bases) |
miRNA location TIGR v3: | chr2:10624938<10625019 |
miRNA location TIGR v5: | chr2:10683551<10683632 |
Folding energy: | -41.70 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR156a |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
** UGACAGAAGA GAGUGAGCAC ACAAAGGCAA UUUGCAUAUC AUUGCACUUG CUUCUCUUGC 60 :((((((((( (((((((((( -((((((((( --((((____ __))))-))) )))---)))- ********** ********** ** GUGCUCACUG CUCUUUCUGU CA 82 )))))))))- )))-)))))) ):

Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2522_50991-51076_63-86
- gnl|BL_ORD_ID|2522_50991+51076_1-24
- gnl|BL_ORD_ID|640_18845-18930_63-86
- gnl|BL_ORD_ID|640_18845+18930_1-24
- gnl|BL_ORD_ID|342_115960-116043_61-84
- gnl|BL_ORD_ID|342_115960+116043_1-24