IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | UCCCUUCGUUUCACAAUAUAA |
encoded miRNA: | MIR55r |
Precursor location: | 407 - 621 (negative strand) |
precursor length: | 215 (63 basepairs) |
MIR position: | 1 - 21 (601 - 621) |
MIR length: | 21 (20 paired bases) |
miRNA location TIGR v3: | chr4:10734006<10734220 |
miRNA location TIGR v5: | chr4:11769012<11769226 |
Folding energy: | -53.29 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * UCCCUUCGUU UCACAAUAUA AGUUGUUUUA ACUAAAAAUA CGUAUAUUAA GAAUAUUUAU 60 (((((((((( (((-(((((( (((((((((( ((((((<<<< <,,,,,,,,, [[[[[[[[__ UUUUAAAAUG UUCAACCAAU UAUAAAAAAA ACUGUAGAAU AUAAAUAAUC AUAAAGUAUU 120 _____]]]]] ]]],,,,,,[ [[[[______ __]]]]],,, ,,,,,,,,,, ,,,,,>>>>> AAAAUAAUAU AUAAUUUGCA UAGAAACUUG AAAACAACUU AUAUUAUAAA ACAAAAAAUU 180 ,,,[[[[[[[ [-------[[ ________]] ---------] ]]]]]]],,, ,,,,,,,,)) UGGUAUAAAA CAACUUAUAU UAUGAAACGG AGGGA 215 ))))-))))) )))))))))) )-)))))))) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2295_85437+85717_261-281