IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | UUAUAUUGUGAAACGAAGGGA |
encoded miRNA: | MIR55q |
Precursor location: | 407 - 621 (positive strand) |
precursor length: | 215 (67 basepairs) |
MIR position: | 195 - 215 (601 - 621) |
MIR length: | 21 (20 paired bases) |
miRNA location TIGR v3: | chr4:10734006>10734220 |
miRNA location TIGR v5: | chr4:11769012>11769226 |
Folding energy: | -52.64 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCCUCCGUU UCAUAAUAUA AGUUGUUUUA UACCAAAUUU UUUGUUUUAU AAUAUAAGUU 60 (((((-(((( (((((((((( (((((((((( ,<<<<<,,,, ,,[[[[--[[ [[[[[[--[[ GUUUUCAAGU UUCUAUGCAA AUUAUAUAUU AUUUUAAUAC UUUAUGAUUA UUUAUAUUCU 120 [[________ ______]]]] ----]]]]]] ]]---]]]], ,,[[[[[___ _]]]]],,,, ACAGUUUUUU UUAUAAUUGG UUGAACAUUU UAAAAAUAAA UAUUCUUAAU AUACGUAUUU 180 ,,,,,,,,,, ,,,,,,>>>> >,,,,,,,,[ [[[[[[[[-- [[[_______ ]]]--]]]]] ****** ********** ***** UUAGUUAAAA CAACUUAUAU UGUGAAACGA AGGGA 215 ]]]],))))) )))))))))) )))))))))- )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2295_85437+85717_261-281