IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | UAUUCCCUUCGUUUCACAAUAUAAG |
encoded miRNA: | MIR55p |
Precursor location: | 404 - 624 (negative strand) |
precursor length: | 221 (66 basepairs) |
MIR position: | 1 - 25 (600 - 624) |
MIR length: | 25 (24 paired bases) |
miRNA location TIGR v3: | chr4:10734003<10734223 |
miRNA location TIGR v5: | chr4:11769009<11769229 |
Folding energy: | -56.59 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** UAUUCCCUUC GUUUCACAAU AUAAGUUGUU UUAACUAAAA AUACGUAUAU UAAGAAUAUU 60 (((((((((( ((((((-((( (((((((((( (((((((((< <<<<,,,,,, ,,,[[[[[[[ UAUUUUUAAA AUGUUCAACC AAUUAUAAAA AAAACUGUAG AAUAUAAAUA AUCAUAAAGU 120 [_______]] ]]]]]],,,, ,,[[[[[___ _____]]]]] ,,,,,,,,,, ,,,,,,,,>> AUUAAAAUAA UAUAUAAUUU GCAUAGAAAC UUGAAAACAA CUUAUAUUAU AAAACAAAAA 180 >>>,,,[[[[ [[[[------ -[[_______ _]]------- --]]]]]]]] ,,,,,,,,,, AUUUGGUAUA AAACAACUUA UAUUAUGAAA CGGAGGGAGU A 221 ,))))))-)) )))))))))) ))))-))))) )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1135_75268+75617_326-350