IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUGAAACGAAGGGAAUA |
encoded miRNA: | MIR55o |
Precursor location: | 404 - 624 (positive strand) |
precursor length: | 221 (67 basepairs) |
MIR position: | 197 - 221 (600 - 624) |
MIR length: | 25 (21 paired bases) |
miRNA location TIGR v3: | chr4:10734003>10734223 |
miRNA location TIGR v5: | chr4:11769009>11769229 |
Folding energy: | -53.54 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UACUCCCUCC GUUUCAUAAU AUAAGUUGUU UUAUACCAAA UUUUUUGUUU UAUAAUAUAA 60 :::(((((-( (((((((((( (((((((((( (((,<<<<<, ,,,,,[[[[- -[[[[[[[[- GUUGUUUUCA AGUUUCUAUG CAAAUUAUAU AUUAUUUUAA UACUUUAUGA UUAUUUAUAU 120 -[[[[_____ _________] ]]]----]]] ]]]]]---]] ]],,,[[[[[ ____]]]]], UCUACAGUUU UUUUUAUAAU UGGUUGAACA UUUUAAAAAU AAAUAUUCUU AAUAUACGUA 180 ,,,,,,,,,, ,,,,,,,,,> >>>>,,,,,, ,,[[[[[[[[ [--[[[____ ___]]]--]] **** ********** ********** * UUUUUAGUUA AAACAACUUA UAUUGUGAAA CGAAGGGAAU A 221 ]]]]]]],)) )))))))))) )))))))))) ))-))))):: :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1135_75268+75617_326-350