IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUGAAACGAAGGGA |
encoded miRNA: | MIR55m |
Precursor location: | 407 - 621 (positive strand) |
precursor length: | 215 (67 basepairs) |
MIR position: | 194 - 215 (600 - 621) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr4:10734006>10734220 |
miRNA location TIGR v5: | chr4:11769012>11769226 |
Folding energy: | -52.64 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCCUCCGUU UCAUAAUAUA AGUUGUUUUA UACCAAAUUU UUUGUUUUAU AAUAUAAGUU 60 (((((-(((( (((((((((( (((((((((( ,<<<<<,,,, ,,[[[[--[[ [[[[[[--[[ GUUUUCAAGU UUCUAUGCAA AUUAUAUAUU AUUUUAAUAC UUUAUGAUUA UUUAUAUUCU 120 [[________ ______]]]] ----]]]]]] ]]---]]]], ,,[[[[[___ _]]]]],,,, ACAGUUUUUU UUAUAAUUGG UUGAACAUUU UAAAAAUAAA UAUUCUUAAU AUACGUAUUU 180 ,,,,,,,,,, ,,,,,,>>>> >,,,,,,,,[ [[[[[[[[-- [[[_______ ]]]--]]]]] ******* ********** ***** UUAGUUAAAA CAACUUAUAU UGUGAAACGA AGGGA 215 ]]]],))))) )))))))))) )))))))))- )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2729_64943+65091_128-149
- gnl|BL_ORD_ID|2729_64943-65091_1-22
- gnl|BL_ORD_ID|2608_89370+89519_129-150
- gnl|BL_ORD_ID|2608_89370-89519_1-22
- gnl|BL_ORD_ID|1990_84920-85067_1-22
- gnl|BL_ORD_ID|1990_84920+85067_127-148