IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUGAAACGAAGG |
encoded miRNA: | MIR55k |
Precursor location: | 409 - 619 (positive strand) |
precursor length: | 211 (65 basepairs) |
MIR position: | 192 - 211 (600 - 619) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr4:10734008>10734218 |
miRNA location TIGR v5: | chr4:11769014>11769224 |
Folding energy: | -47.44 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CCUCCGUUUC AUAAUAUAAG UUGUUUUAUA CCAAAUUUUU UGUUUUAUAA UAUAAGUUGU 60 (((-(((((( (((((((((( ((((((((,< <<<<,,,,,, [[[[--[[[[ [[[[--[[[[ UUUCAAGUUU CUAUGCAAAU UAUAUAUUAU UUUAAUACUU UAUGAUUAUU UAUAUUCUAC 120 __________ ____]]]]-- --]]]]]]]] ---]]]],,, [[[[[____] ]]]],,,,,, AGUUUUUUUU AUAAUUGGUU GAACAUUUUA AAAAUAAAUA UUCUUAAUAU ACGUAUUUUU 180 ,,,,,,,,,, ,,,,>>>>>, ,,,,,,,[[[ [[[[[[--[[ [_______]] ]--]]]]]]] ********* ********** * AGUUAAAACA ACUUAUAUUG UGAAACGAAG G 211 ]],))))))) )))))))))) )))))))-)) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2812_31009-31128_1-20
- gnl|BL_ORD_ID|2812_31009+31128_101-120
- gnl|BL_ORD_ID|2621_2328+2447_101-120
- gnl|BL_ORD_ID|2621_2328-2447_1-20