IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGAAGG |
encoded miRNA: | MIR55g |
Precursor location: | 409 - 619 (positive strand) |
precursor length: | 211 (65 basepairs) |
MIR position: | 191 - 211 (599 - 619) |
MIR length: | 21 (20 paired bases) |
miRNA location TIGR v3: | chr4:10734008>10734218 |
miRNA location TIGR v5: | chr4:11769014>11769224 |
Folding energy: | -47.44 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CCUCCGUUUC AUAAUAUAAG UUGUUUUAUA CCAAAUUUUU UGUUUUAUAA UAUAAGUUGU 60 (((-(((((( (((((((((( ((((((((,< <<<<,,,,,, [[[[--[[[[ [[[[--[[[[ UUUCAAGUUU CUAUGCAAAU UAUAUAUUAU UUUAAUACUU UAUGAUUAUU UAUAUUCUAC 120 __________ ____]]]]-- --]]]]]]]] ---]]]],,, [[[[[____] ]]]],,,,,, AGUUUUUUUU AUAAUUGGUU GAACAUUUUA AAAAUAAAUA UUCUUAAUAU ACGUAUUUUU 180 ,,,,,,,,,, ,,,,>>>>>, ,,,,,,,[[[ [[[[[[--[[ [_______]] ]--]]]]]]] ********** ********** * AGUUAAAACA ACUUAUAUUG UGAAACGAAG G 211 ]],))))))) )))))))))) )))))))-)) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1448_81463+81616_134-154
- gnl|BL_ORD_ID|708_29153+29297_125-145
- gnl|BL_ORD_ID|708_29153-29297_1-21