IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGAAG |
encoded miRNA: | MIR55f |
Precursor location: | 410 - 618 (positive strand) |
precursor length: | 209 (62 basepairs) |
MIR position: | 190 - 209 (599 - 618) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr4:10734009>10734217 |
miRNA location TIGR v5: | chr4:11769015>11769223 |
Folding energy: | -44.54 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCGUUUCA UAAUAUAAGU UGUUUUAUAC CAAAUUUUUU GUUUUAUAAU AUAAGUUGUU 60 :::((((((( (((((((((( (((((((,<< <<<,,,,,,[ [[[--[[[[[ [[[--[[[[_ UUCAAGUUUC UAUGCAAAUU AUAUAUUAUU UUAAUACUUU AUGAUUAUUU AUAUUCUACA 120 __________ ___]]]]--- -]]]]]]]]- --]]]],,,[ [[[[____]] ]]],,,,,,, GUUUUUUUUA UAAUUGGUUG AACAUUUUAA AAAUAAAUAU UCUUAAUAUA CGUAUUUUUA 180 ,,,,,,,,,, ,,,>>>>>,, ,,,,,,[[[[ [[[[[--[[[ _______]]] --]]]]]]]] * ********** ********* GUUAAAACAA CUUAUAUUGU GAAACGAAG 209 ],)))))))) )))))))))) )))))):::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|988_45032-45173_1-20
- gnl|BL_ORD_ID|988_45032+45173_123-142
- gnl|BL_ORD_ID|928_74867-74990_1-20
- gnl|BL_ORD_ID|928_74867+74990_105-124