IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGAAGGGA |
encoded miRNA: | MIR55 |
Precursor location: | 407 - 621 (positive strand) |
precursor length: | 215 (67 basepairs) |
MIR position: | 192 - 215 (598 - 621) |
MIR length: | 24 (23 paired bases) |
miRNA location TIGR v3: | chr4:10734006>10734220 |
miRNA location TIGR v5: | chr4:11769012>11769226 |
Folding energy: | -52.64 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster002 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCCUCCGUU UCAUAAUAUA AGUUGUUUUA UACCAAAUUU UUUGUUUUAU AAUAUAAGUU 60 (((((-(((( (((((((((( (((((((((( ,<<<<<,,,, ,,[[[[--[[ [[[[[[--[[ GUUUUCAAGU UUCUAUGCAA AUUAUAUAUU AUUUUAAUAC UUUAUGAUUA UUUAUAUUCU 120 [[________ ______]]]] ----]]]]]] ]]---]]]], ,,[[[[[___ _]]]]],,,, ACAGUUUUUU UUAUAAUUGG UUGAACAUUU UAAAAAUAAA UAUUCUUAAU AUACGUAUUU 180 ,,,,,,,,,, ,,,,,,>>>> >,,,,,,,,[ [[[[[[[[-- [[[_______ ]]]--]]]]] ********* ********** ***** UUAGUUAAAA CAACUUAUAU UGUGAAACGA AGGGA 215 ]]]],))))) )))))))))) )))))))))- )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g14390.1 | 68408.m01542 leucine-rich repeat transmembrane protein kinase, putative | 4 | 2 |
2 | At1g68720.1 | 68408.m07206 deaminase -related | 4 | 1 |
Rice homologs
- gnl|BL_ORD_ID|612_162049+162196_125-148
- gnl|BL_ORD_ID|612_162049-162196_1-24
- gnl|BL_ORD_ID|3273_63639+63793_132-155
- gnl|BL_ORD_ID|3273_63639-63793_1-24
- gnl|BL_ORD_ID|3196_75929+76066_115-138
- gnl|BL_ORD_ID|3084_165765+165843_56-79
- gnl|BL_ORD_ID|2119_136406+136521_93-116
- gnl|BL_ORD_ID|2119_136406-136521_1-24
- gnl|BL_ORD_ID|1979_168072-168221_1-24
- gnl|BL_ORD_ID|1808_6611-6746_1-24
- gnl|BL_ORD_ID|1156_28116+28194_56-79
- gnl|BL_ORD_ID|915_42762-42916_1-24
- gnl|BL_ORD_ID|915_42762+42916_132-155
- gnl|BL_ORD_ID|621_141576-141711_1-24
- gnl|BL_ORD_ID|62_48374+48521_125-148