IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGAAGG |
encoded miRNA: | MIR55c |
Precursor location: | 409 - 619 (positive strand) |
precursor length: | 211 (65 basepairs) |
MIR position: | 190 - 211 (598 - 619) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr4:10734008>10734218 |
miRNA location TIGR v5: | chr4:11769014>11769224 |
Folding energy: | -47.44 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster002 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CCUCCGUUUC AUAAUAUAAG UUGUUUUAUA CCAAAUUUUU UGUUUUAUAA UAUAAGUUGU 60 (((-(((((( (((((((((( ((((((((,< <<<<,,,,,, [[[[--[[[[ [[[[--[[[[ UUUCAAGUUU CUAUGCAAAU UAUAUAUUAU UUUAAUACUU UAUGAUUAUU UAUAUUCUAC 120 __________ ____]]]]-- --]]]]]]]] ---]]]],,, [[[[[____] ]]]],,,,,, AGUUUUUUUU AUAAUUGGUU GAACAUUUUA AAAAUAAAUA UUCUUAAUAU ACGUAUUUUU 180 ,,,,,,,,,, ,,,,>>>>>, ,,,,,,,[[[ [[[[[[--[[ [_______]] ]--]]]]]]] * ********** ********** * AGUUAAAACA ACUUAUAUUG UGAAACGAAG G 211 ]],))))))) )))))))))) )))))))-)) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g14390.1 | 68408.m01542 leucine-rich repeat transmembrane protein kinase, putative | 3 | 2 |
Rice homologs
- gnl|BL_ORD_ID|1795_33957+34070_93-114
- gnl|BL_ORD_ID|1795_33957-34070_1-22
- gnl|BL_ORD_ID|881_10211-10324_1-22
- gnl|BL_ORD_ID|881_10211+10324_93-114