IGR sequence: | igr2076#chr4#x1=10733600#l=1162 |
---|---|
Mature miRNA sequence: | CCUUCGUUUCACAAUAUAAGUUGUU |
encoded miRNA: | MIR55b |
Precursor location: | 409 - 619 (negative strand) |
precursor length: | 211 (61 basepairs) |
MIR position: | 1 - 25 (595 - 619) |
MIR length: | 25 (24 paired bases) |
miRNA location TIGR v3: | chr4:10734008<10734218 |
miRNA location TIGR v5: | chr4:11769014<11769224 |
Folding energy: | -48.09 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** CCUUCGUUUC ACAAUAUAAG UUGUUUUAAC UAAAAAUACG UAUAUUAAGA AUAUUUAUUU 60 (((((((((( (-(((((((( (((((((((( ((((<<<<<, ,,,,,,,,[[ [[[[[[____ UUAAAAUGUU CAACCAAUUA UAAAAAAAAC UGUAGAAUAU AAAUAAUCAU AAAGUAUUAA 120 ___]]]]]]] ],,,,,,[[[ [[________ ]]]]],,,,, ,,,,,,,,,, ,,,>>>>>,, AAUAAUAUAU AAUUUGCAUA GAAACUUGAA AACAACUUAU AUUAUAAAAC AAAAAAUUUG 180 ,[[[[[[[[- ------[[__ ______]]-- -------]]] ]]]]],,,,, ,,,,,,)))) GUAUAAAACA ACUUAUAUUA UGAAACGGAG G 211 ))-))))))) )))))))))- )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1208_16171-16326_1-25
- gnl|BL_ORD_ID|1208_16171+16326_132-156