IGR sequence: | igr2044#chr5#x1=9109684#l=5223 |
---|---|
Mature miRNA sequence: | GUGUGCUCACUCUCUUCUGUCA |
encoded miRNA: | MIR17c |
Precursor location: | 4190 - 4279 (negative strand) |
precursor length: | 90 (33 basepairs) |
MIR position: | 69 - 90 (4190 - 4211) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr5:9113873<9113962 |
miRNA location TIGR v5: | chr5:9136129<9136218 |
Folding energy: | -46.00 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR156f |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UGACGGAUAG AGAGUGAGCA CACAUAGCUU CAAGCAUGGA ACCUUCAAAU AUGCAAGAAA 60 :((((((-(( (((((((((( (((((-(((( (--(((((__ _________) ))))--)-)) ** ********** ********** GCCACCAUGU GUGCUCACUC UCUUCUGUCA 90 ))----)))) )))))))))) ))))))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2094_35724+35970_1-22
- gnl|BL_ORD_ID|2094_35724+35969_1-22
- gnl|BL_ORD_ID|2094_35724+35809_1-22
- gnl|BL_ORD_ID|2094_35724-35809_65-86
- gnl|BL_ORD_ID|2094_35724-35804_60-81
- gnl|BL_ORD_ID|342_115900-116035_115-136
- gnl|BL_ORD_ID|342_115900+115983_1-22
- gnl|BL_ORD_ID|342_115900-115983_63-84
- gnl|BL_ORD_ID|342_115900-115978_58-79
- gnl|BL_ORD_ID|62_1183-1268_65-86
- gnl|BL_ORD_ID|62_1183-1263_60-81
- gnl|BL_ORD_ID|62_1183+1268_1-22
- gnl|BL_ORD_ID|62_1183+1429_1-22
- gnl|BL_ORD_ID|62_1183+1428_1-22