IGR sequence: | igr1987#chr3#x1=8101048#l=11724 |
---|---|
Mature miRNA sequence: | UGAAGCUGCCAGCAUGAUCUA |
encoded miRNA: | MIR54d |
Precursor location: | 7050 - 7150 (positive strand) |
precursor length: | 101 (39 basepairs) |
MIR position: | 1 - 21 (7050 - 7070) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr3:8108097>8108197 |
miRNA location TIGR v5: | chr3:8108097>8108197 |
Folding energy: | -43.50 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR167a |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * UGAAGCUGCC AGCAUGAUCU AAUUAGCUUU CUUUAUCCUU UGUUGUGUUU CAUGACGAUG 60 :((((((((- (((((((((( ((((((((-( ((((--((-( (((--((___ ))--))))-) GUUAAGAGAU CAGUCUCGAU UAGAUCAUGU UCGCAGUUUC A 101 )---)))))- -))-))-))) )))))))))) )-)))))))) :

Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3217_79800+79914_1-21
- gnl|BL_ORD_ID|3217_79800-79914_95-115
- gnl|BL_ORD_ID|1022_85031+85157_1-21
- gnl|BL_ORD_ID|1022_85031-85157_107-127