IGR sequence: | igr1656#chr3#x1=6684108#l=3037 |
---|---|
Mature miRNA sequence: | UCUGUAUUUGGAAGUAAUGA |
encoded miRNA: | MIR42a |
Precursor location: | 1861 - 2210 (negative strand) |
precursor length: | 350 (117 basepairs) |
MIR position: | 1 - 20 (2191 - 2210) |
MIR length: | 20 (20 paired bases) |
miRNA location TIGR v3: | chr3:6685968<6686317 |
miRNA location TIGR v5: | chr3:6685968<6686317 |
Folding energy: | -144.20 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UCUGUAUUUG GAAGUAAUGA UCUUAGACUC CACGCGACAG UGUUCUUUAC UCCUACCAAA 60 (((((((((( (((((((((( (((((((((( ((((((((-( (((((((((, ,,,,,,,,,, AAAAAAGAAA AAACUAUAAA CUAUGAAUAA AAUAUGACCA AAACAUGUAG UUAAUUGGGU 120 ,,,,,,<<<- --<<<-<-<< <-<<<<<--- -<<<--<<<< -<<<<<<<<- <<<<<<<<<< UGUGCUAUUU UUAUCAUUAU GUUAUCACCC GAAAUUUGAA UAUAUGUUAU GGUUGUGUGA 180 -<<<-<<<__ ________>> >->>>->>>> >>--->>>>- >>>>>>>>-> >>>-->>>-- CUUUUAUGUU AAAAGUGUUC CCUCAUCAGA UAGAAGAAGU GGUGGUGCUU GCUUUCUUUU 240 -->>>>>>>> ->->>>->>> ,,,,,,,,,, ,,<<<<<-<< <<<<,,[[[[ [[--[[---- UGGGAGCCCA UUUUGGUUGC AAGCCAAUAA GAAUAUCACA CCGCUCUUCG AAACAAAACA 300 [[[____]]] ----]]--]] ]]]],,,,,, [_____],>> >>>>>>>>>, ,,,,,,,,,, AUAAAGAACA CAGUCGCGUG GAGUCUAAGA UCAUUACUUC CAAAUACAGA 350 ,))))))))) )-)))))))) )))))))))) )))))))))) ))))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1622_98566+98831_247-266
- gnl|BL_ORD_ID|1480_156180+156445_247-266