IGR sequence: | igr961#chr1#x1=3960414#l=2862 |
---|---|
Mature miRNA sequence: | CGUGAUAUUGGCACGGCUCAAUC |
encoded miRNA: | MIR58a |
Precursor location: | 954 - 1039 (positive strand) |
precursor length: | 86 (29 basepairs) |
MIR position: | 1 - 23 (954 - 976) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr1:3961367>3961452 |
miRNA location TIGR v5: | chr1:3961367>3961452 |
Folding energy: | -30.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** CGUGAUAUUG GCACGGCUCA AUCGAACAAC ACCGUUCUCC AUGAGUUAAG AGGACGACUA 60 ((-((((((( (--(((-((( ((((((---- --(((((((_ _________) ))))))---- UUUGAUUGAA CCGCACUAAU AUCUCG 86 )))))))))- )))--))))) )))-))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2328_80669+80753_1-23
- gnl|BL_ORD_ID|2328_80669-80753_63-85
- gnl|BL_ORD_ID|2115_32492-32577_64-86
- gnl|BL_ORD_ID|2115_32492+32577_1-23
- gnl|BL_ORD_ID|1407_77115-77200_64-86
- gnl|BL_ORD_ID|1407_77115+77200_1-23