IGR sequence: | igr1656#chr3#x1=6684108#l=3037 |
---|---|
Mature miRNA sequence: | UCAUUACUUCCAAAUACAGA |
encoded miRNA: | MIR42 |
Precursor location: | 1861 - 2210 (positive strand) |
precursor length: | 350 (115 basepairs) |
MIR position: | 331 - 350 (2191 - 2210) |
MIR length: | 20 (20 paired bases) |
miRNA location TIGR v3: | chr3:6685968>6686317 |
miRNA location TIGR v5: | chr3:6685968>6686317 |
Folding energy: | -128.65 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCUGUAUUUG GAAGUAAUGA UCUUAGACUC CACGCGACUG UGUUCUUUAU UGUUUUGUUU 60 (((((((((( (((((((((( (((((((((( ((((((((-( (((((((((( (,,,,,,,,, CGAAGAGCGG UGUGAUAUUC UUAUUGGCUU GCAACCAAAA UGGGCUCCCA AAAAGAAAGC 120 ,<<<<-<-<< <<<----<<< <<-<<<<--- <<--<<____ _>>>>-->>> >->>>>>--- AAGCACCACC ACUUCUUCUA UCUGAUGAGG GAACACUUUU AACAUAAAAG UCACACAACC 180 -->>>>>->- ->>>>,,<<< <<-<<-<<<- -<<-<<<--- <<<,,,,,,[ [[[[----[[ AUAACAUAUA UUCAAAUUUC GGGUGAUAAC AUAAUGAUAA AAAUAGCACA ACCCAAUUAA 240 __________ __________ ]]]]]]],,, ,,,[[[[--[ [[[[[----- --[[[[--[[ CUACAUGUUU UGGUCAUAUU UUAUUCAUAG UUUAUAGUUU UUUCUUUUUU UUUGGUAGGA 300 [_____]]]] ]]]---]]]] ]]--]]]],> >>--->>>-> >-->>>->>- --->>>>>,) ********** ********** GUAAAGAACA CUGUCGCGUG GAGUCUAAGA UCAUUACUUC CAAAUACAGA 350 )))))))))) )-)))))))) )))))))))) )))))))))) ))))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1622_98566+98831_247-266
- gnl|BL_ORD_ID|1480_156180+156445_247-266