IGR sequence: | igr83#chr2#x1=419482#l=5268 |
---|---|
Mature miRNA sequence: | ACUUAUAAUGAAACGGAGGGAGUA |
encoded miRNA: | MIR79a |
Precursor location: | 4286 - 4464 (positive strand) |
precursor length: | 179 (54 basepairs) |
MIR position: | 156 - 179 (4441 - 4464) |
MIR length: | 24 (19 paired bases) |
miRNA location TIGR v3: | chr2:423767>423945 |
miRNA location TIGR v5: | chr2:424767>424945 |
Folding energy: | -39.38 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCUUUGUUU CACAAUAUAA GUUGUUUUAG CUAAAAGCAC GCAGAUUAAG AAUAUUUACU 60 (((((((((( ((---((((( ((((((((,< <_____>>,, <<<<<<<<,[ [-[[[[[[-- UUUAAAAAGU UCAACCAAUC ACAAAAGAGA CUACAUAAUA UAAAUAAUCA UAAAAUAUUA 120 [[-------[ [[________ ______]]]- ------]]-- ]]]]]]-]], ,,,,[[[[[[ ***** ********** ********* AAGUAAUAUA UAAUUUGCAU AGAAACUUGA AAACAACUUA UAAUGAAACG GAGGGAGUA 179 ___]]]]]], >>>>>>>>,, ,,,,,,,,,) )))))))))) ))-))))))) )))))::::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1812_16262+16499_215-238
- gnl|BL_ORD_ID|1812_16262-16499_1-24
- gnl|BL_ORD_ID|671_10689-10926_1-24
- gnl|BL_ORD_ID|671_10689+10926_215-238
- gnl|BL_ORD_ID|3529_111959-112203_1-24
- gnl|BL_ORD_ID|1856_52468-52707_1-24
- gnl|BL_ORD_ID|176_6787-7026_1-24