IGR sequence: | igr83#chr2#x1=419482#l=5268 |
---|---|
Mature miRNA sequence: | ACUUAUAAUGAAACGGAGGGAGU |
encoded miRNA: | MIR79 |
Precursor location: | 4286 - 4463 (positive strand) |
precursor length: | 178 (54 basepairs) |
MIR position: | 156 - 178 (4441 - 4463) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr2:423767>423944 |
miRNA location TIGR v5: | chr2:424767>424944 |
Folding energy: | -39.38 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCUUUGUUU CACAAUAUAA GUUGUUUUAG CUAAAAGCAC GCAGAUUAAG AAUAUUUACU 60 (((((((((( ((---((((( ((((((((,< <_____>>,, <<<<<<<<,[ [-[[[[[[-- UUUAAAAAGU UCAACCAAUC ACAAAAGAGA CUACAUAAUA UAAAUAAUCA UAAAAUAUUA 120 [[-------[ [[________ ______]]]- ------]]-- ]]]]]]-]], ,,,,[[[[[[ ***** ********** ******** AAGUAAUAUA UAAUUUGCAU AGAAACUUGA AAACAACUUA UAAUGAAACG GAGGGAGU 178 ___]]]]]], >>>>>>>>,, ,,,,,,,,,) )))))))))) ))-))))))) ))))):::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3533_57107-57361_1-23
- gnl|BL_ORD_ID|3533_57107+57361_233-255
- gnl|BL_ORD_ID|2162_102749+103003_233-255
- gnl|BL_ORD_ID|2162_102749-103003_1-23